The Hatchet ribozyme is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. Hatchet ribozymes were discovered by a bioinformatics strategy as RNAs Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH. Subsequent biochemical analysis supports the conclusion of a ribozyme function, and determined further characteristics of the chemical reaction catalyzed by the ribozyme. Nucleolytic ribozymes are small RNAs that adopt compact folds capable of site-specific cleavage/ligation reactions. 14 unique nucleolytic ribozymes have been identified to date, including recently discovered twister, pistol, twister-sister, and Hatchet ribozymes that were identified based on application of comparative sequence and structural algorithms. The consensus sequence and secondary structure of this class includes 13 highly conserved and numerous other modestly conserved nucleotides inter-dispersed among bulges linking four base-paired substructures. A representative Hatchet ribozyme requires divalent cations such as Mg2+ to promote RNA strand scission with a maximum rate constant of ~4/min. As with all other small self-cleaving ribozymes discovered to date, Hatchet ribozymes employ a general mechanism for catalysis consisting of a nucleophilic attack of a ribose 2′-oxygen atom on the adjacent phosphorus center. Kinetic characteristics of the reaction demonstrate that members of this ribozyme class have an essential requirement for divalent metal cations and that they have a complex active site which employs multiple catalytic strategies to accelerate RNA cleavage by internal phosphoester transfer.
Mechanism Nucleolytic ribozymes like the Hatchet ribozyme adopt an SN2-like mechanism that results in site-specific phosphodiester bond cleavage. An activated 2′-OH of the ribose 5′ to the scissile phosphate adopts an in-line alignment to target the adjacent to-be-cleaved P-O5′ phosphodiester bond, resulting in formation of 2′,3′-cyclic phosphate and 5′-OH groups. X-ray crystallographic structural studies on the hammerhead, hairpin, GlmS, hepatitis delta virus (HDV), Varkud satellite, and pistol ribozymes have defined the overall RNA fold, the catalytic pocket arrangement, the in-line alignment, and the key residues that contribute to the cleavage reaction. The cleavage site is located at the 5' end of its consensus secondary motif. In addition, the removal of the nucleophilic hydroxyl renders the ribozyme inactive as it is not able to create the cleavage site. More specifically, if the 2'-ribose or 2'-OH is replaced with a 2'-deoxyribose or 2'-H, there are no electrons available to perform the nucleophilic attack on the adjacent phosphate group. This results in no phosphoester bond being formed, which again inactivates the ribozyme's enzymatic cleavage ability.
Secondary Structure In 2019, researchers crystallized a 2.1 Å product of the Hatchet ribozyme. The consensus sequence is depicted in the image to the right. Most Hatchet ribozymes and ribozymes in general adopt a P0 configuration. P0 is an additional hairpin loop located at the 5' end of the cleavage site, though it does not contribute to catalytic activity or functionality unlike Hammerhead ribozymes which have a short consensus sequence near P1, or the 5' end, that promotes high speed catalytic activity. About 90% of the sequence is conserved and similar to other ribozymes in this class. Based on the RNA sequence, the resulting DNA sequence which ends up coding for the Hatchet ribozyme is as follows from 5'-3' because in DNA uracil is replaced by thymine. TTAGCAAGAATGACTATAGTCACTG TTTGTACACCCCGAATAGATTAGAA GCCTAATCATAATCACGTCTGCAAT TTTGGTACA Due to this sequence construct, after self catalyzed cleavage, it leaves an 8 nucleotide residue upstream on the 3'-end of the RNA.
Tertiary Structure Each ribozyme may have different motifs and thus different tertiary structures: The Tertiary structure of the Hatchet ribozyme with the motif of HT-UUCG is through dimerization. The dimer is formed through the swapping of the 3' ends of the pairing strands which is also in equilibrium with the dimer formed product of HT-GAAA. Therefore, the RNA sequence shifts between monomer and dimer configurations. To view the 3-D shape of the ribozyme see Figure S1A and B. Two molecules of the HT-GAAA ribozyme can actually form a pseudosymmetric dimer with both monomers of the ribozyme exhibiting relatively well-defined electron density. The tertiary fold consists of four stem substructures which covalently stack upon each other forming the helical and loop structures, called P1, P2, P3, and P4, L1, L2 and L3 respectively (though not shown in the figure above). The actual cleavage site is positioned between the junction of P1 and P2 adjacent to P3 and L2. P1 is composed of three or six base pairs roughly 40% and 60% of the time respectively in its natural state, suggesting that length corresponds to catalytic function. There is also a conserved palindromic sequencing between base U70' and A67', which likely triggers the formation of the dimer due to Watson-Crick base pair interactions. The tertiary structure also has long range implications within itself based on interactions between its loops.
… excerpt ends here. Continue reading the full article.
