ArticleslgStudy

mathematics

Subsequence

Subsequence is a mathematics topic covered in the lgStudy science library. This page brings together a partial reference excerpt, illustrations, worked examples, real-world applications and a short study plan, so you can understand Subsequence rather than just read about it. In short: In mathematics, a subsequence of a given sequence is a sequence that can be derived from the given sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence ⟨ A , B , D ⟩ {\displaystyle \langle A,B,D\rangle } is a subsequence of ⟨ A , B , C , D , E , F ⟩ {\displaystyle \langle A,B,C,D,E,F\rangle } obtained after removal of elements C , {\displaystyle C,}…

Key takeaways

  • Subsequence belongs to mathematics; place it in that map before memorising details.
  • Learn the definition first, then one example that makes the definition concrete.
  • Connect Subsequence to a quantity you can measure, compute or draw — that is where exam questions come from.
  • Reproduce the core statement of Subsequence from memory before moving on to harder problems.

Reference excerpt

In mathematics, a subsequence of a given sequence is a sequence that can be derived from the given sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence ⟨ A , B , D ⟩ {\displaystyle \langle A,B,D\rangle } is a subsequence of ⟨ A , B , C , D , E , F ⟩ {\displaystyle \langle A,B,C,D,E,F\rangle } obtained after removal of elements C , {\displaystyle C,} E , {\displaystyle E,} and F . {\displaystyle F.} The relation of one sequence being the subsequence of another is a partial order. Subsequences can contain consecutive elements which were not consecutive in the original sequence. A subsequence which consists of a consecutive run of elements from the original sequence, such as ⟨ B , C , D ⟩ , {\displaystyle \langle B,C,D\rangle ,} from ⟨ A , B , C , D , E , F ⟩ , {\displaystyle \langle A,B,C,D,E,F\rangle ,} is a substring. The substring is a refinement of the subsequence. The list of all subsequences for the word "apple" would be "a", "ap", "al", "ae", "app", "apl", "ape", "ale", "appl", "appe", "aple", "apple", "p", "pp", "pl", "pe", "ppl", "ppe", "ple", "pple", "l", "le", "e", "" (empty string).

Common subsequence Given two sequences X {\displaystyle X} and Y , {\displaystyle Y,} a sequence Z {\displaystyle Z} is said to be a common subsequence of X {\displaystyle X} and Y , {\displaystyle Y,} if Z {\displaystyle Z} is a subsequence of both X {\displaystyle X} and Y . {\displaystyle Y.} For example, if

X = ⟨ A , C , B , D , E , G , C , E , D , B , G ⟩ and {\displaystyle X=\langle A,C,B,D,E,G,C,E,D,B,G\rangle \qquad {\text{ and}}}

Y = ⟨ B , E , G , J , C , F , E , K , B ⟩ and {\displaystyle Y=\langle B,E,G,J,C,F,E,K,B\rangle \qquad {\text{ and}}}

Z = ⟨ B , E , E ⟩ . {\displaystyle Z=\langle B,E,E\rangle .}

then Z {\displaystyle Z} is said to be a common subsequence of X {\displaystyle X} and Y . {\displaystyle Y.}

This would not be the longest common subsequence, since Z {\displaystyle Z} only has length 3, and the common subsequence ⟨ B , E , E , B ⟩ {\displaystyle \langle B,E,E,B\rangle } has length 4. The longest common subsequence of X {\displaystyle X} and Y {\displaystyle Y} is ⟨ B , E , G , C , E , B ⟩ . {\displaystyle \langle B,E,G,C,E,B\rangle .}

Applications Subsequences have applications to computer science, especially in the discipline of bioinformatics, where computers are used to compare, analyze, and store DNA, RNA, and protein sequences. Take two sequences of DNA containing 37 elements, say:

SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA The longest common subsequence of sequences 1 and 2 is:

LCS(SEQ1,SEQ2) = CGTTCGGCTATGCTTCTACTTATTCTA This can be illustrated by highlighting the 27 elements of the longest common subsequence into the initial sequences:

SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA Another way to show this is to align the two sequences, that is, to position elements of the longest common subsequence in a same column (indicated by the vertical bar) and to introduce a special character (here, a dash) for padding of arisen empty subsequences:

SEQ1 = ACGGTGTCGTGCTAT-G--C-TGATGCTGA--CT-T-ATATG-CTA- | || ||| ||||| | | | | || | || | || | ||| SEQ2 = -C-GT-TCG-GCTATCGTACGT--T-CT-ATTCTATGAT-T-TCTAA Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

… excerpt ends here. Continue reading the full article.

Worked examples

Example 1 — a first encounter with Subsequence

Start with the simplest possible case. Write down what Subsequence claims or describes in one sentence, then invent the smallest concrete situation in which that sentence is true. In mathematics, the smallest case is usually a single object, a single equation or a single measurement. Check that every symbol or term in your sentence has a meaning in that case.

Example 2 — changing one variable

Take the situation from Example 1 and change exactly one quantity: double it, halve it, or set it to zero. Predict what should happen to Subsequence before you calculate. Comparing your prediction with the result is the fastest way to find out whether you understand the idea or only the words.

Example 3 — an exam-style question

Typical questions about Subsequence ask you to (a) state it precisely, (b) apply it to given data, and (c) explain a limitation. Practise writing all three answers in under five minutes; the third part is what separates a full-mark answer from an average one.

Applications of Subsequence

In research
Subsequence appears in mathematics research whenever the underlying quantities have to be modelled precisely. Papers usually cite it as a starting assumption and then explore where it breaks down.
In technology and industry
Engineering practice reuses Subsequence in design rules, simulations and safety margins. Knowing the idea lets you read a specification sheet and understand why the numbers look the way they do.
In the classroom
Subsequence is common in secondary-school and first-year university syllabi. It links to neighbouring topics Elementary mathematics, Sequences and series, so understanding it makes those chapters shorter.
In everyday life
Look for Subsequence outside the textbook — in sport, cooking, traffic, electronics or the sky above you. An example you found yourself is remembered far longer than one you were given.
Ask Teacher Smith questions about this articleOpens your AI tutor with a question about “Subsequence” →

Affiliate

Preply — study more efficiently by working with a personal tutor. 50% off.

How to study Subsequence in 20 minutes

  1. Read the reference excerpt below once, without taking notes.
  2. Close the page and write down what Subsequence means in your own words.
  3. Compare your version with the excerpt and mark what you missed.
  4. Work through the three examples above with pen and paper.
  5. Explain Subsequence out loud to somebody else — or to Teacher Smith in the lgStudy chat.

Frequently asked questions

What is Subsequence in simple terms?

In mathematics, a subsequence of a given sequence is a sequence that can be derived from the given sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence ⟨ A , B , D ⟩ {\displaystyle \langle A,B,D\rangle } is a subsequence of ⟨ A , B…

Why does Subsequence matter?

Because it connects several mathematics ideas at once: it gives you a definition you can apply, a quantity you can calculate, and a way to check whether a result is plausible.

How should I study Subsequence?

Read the excerpt, restate it from memory, then work through the examples and applications listed on this page. The five-step study plan above takes about twenty minutes.

What does this page cover?

It gives you a compact reference excerpt plus original lgStudy explanations, examples, applications and study material on Subsequence.

Tags

  • Elementary mathematics
  • Sequences and series

Keep exploring