chemistry

T7 RNA polymerase

T7 RNA polymerase is a chemistry topic covered in the lgStudy science library. This page brings together a partial reference excerpt, illustrations, worked examples, real-world applications and a short study plan, so you can understand T7 RNA polymerase rather than just read about it. In short: T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter.

Key takeaways

T7 RNA polymerase belongs to chemistry; place it in that map before memorising details.
Learn the definition first, then one example that makes the definition concrete.
Connect T7 RNA polymerase to a quantity you can measure, compute or draw — that is where exam questions come from.
Reproduce the core statement of T7 RNA polymerase from memory before moving on to harder problems.

Reference excerpt

T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.

Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.

Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:

5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init

Transcription begins at the asterisk-marked guanine.

Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp. A beta-hairpin specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead. Similar to other viral nucleic acid polymerases, including T7 DNA polymerase from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand with three subdomains termed fingers, palm, and thumb. The N-terminal is less conserved. It forms a promoter-binding domain (PBD) with helix bundles in phage ssRNAPs, a feature not found in mitochondrial ssRNAPs.

Related proteins

T7 polymerase is a representative member of the single-subunit DNA-dependent RNAP (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase (POLRMT), and the chloroplastic ssRNAP. The ssRNAP family is structurally and evolutionarily distinct from the multi-subunit family of RNA polymerases (including bacterial and eukaryotic sub-families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic rifampicin. This family is related to single-subunit reverse transcriptase and DNA polymerase.

Application In biotechnology applications, T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into vectors that have two (different) phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can be selectively synthesized from either strand of the insert DNA with the different polymerases. Linearized plasmids or PCR products can be used as a DNA template. The enzyme is stimulated by spermidine and in vitro activity is increased by the presence of carrier proteins (such as BSA). Homogeneously labeled single-stranded RNA can be generated with this system. Transcripts can be non-radioactively labeled to high specific activity with certain labeled nucleotides. T7 RNA polymerase is used in the synthesis of mRNA and sgRNA. Transcripts that are generated via T7 RNA polymerase typically have Guanosine as the +1 and +2 bases to increase yield, although alternative promoter sequences to include adenine as the first nucleotide are also available. For mRNA, the transcripts can be co-transcriptionally capped by including a mRNA cap structure analog in the transcription reaction.

Illustrations

Worked examples

Example 1 — a first encounter with T7 RNA polymerase

Start with the simplest possible case. Write down what T7 RNA polymerase claims or describes in one sentence, then invent the smallest concrete situation in which that sentence is true. In chemistry, the smallest case is usually a single object, a single equation or a single measurement. Check that every symbol or term in your sentence has a meaning in that case.

Example 2 — changing one variable

Take the situation from Example 1 and change exactly one quantity: double it, halve it, or set it to zero. Predict what should happen to T7 RNA polymerase before you calculate. Comparing your prediction with the result is the fastest way to find out whether you understand the idea or only the words.

Example 3 — an exam-style question

Typical questions about T7 RNA polymerase ask you to (a) state it precisely, (b) apply it to given data, and (c) explain a limitation. Practise writing all three answers in under five minutes; the third part is what separates a full-mark answer from an average one.

Applications of T7 RNA polymerase

In research: T7 RNA polymerase appears in chemistry research whenever the underlying quantities have to be modelled precisely. Papers usually cite it as a starting assumption and then explore where it breaks down.
In technology and industry: Engineering practice reuses T7 RNA polymerase in design rules, simulations and safety margins. Knowing the idea lets you read a specification sheet and understand why the numbers look the way they do.
In the classroom: T7 RNA polymerase is common in secondary-school and first-year university syllabi. It links to neighbouring topics Phage proteins, RNA, T-phages, so understanding it makes those chapters shorter.
In everyday life: Look for T7 RNA polymerase outside the textbook — in sport, cooking, traffic, electronics or the sky above you. An example you found yourself is remembered far longer than one you were given.

Ask Teacher Smith questions about this articleOpens your AI tutor with a question about “T7 RNA polymerase” →

Affiliate

Preply — study more efficiently by working with a personal tutor. 50% off.

How to study T7 RNA polymerase in 20 minutes

Read the reference excerpt below once, without taking notes.
Close the page and write down what T7 RNA polymerase means in your own words.
Compare your version with the excerpt and mark what you missed.
Work through the three examples above with pen and paper.
Explain T7 RNA polymerase out loud to somebody else — or to Teacher Smith in the lgStudy chat.

Frequently asked questions

What is T7 RNA polymerase in simple terms?

T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter.

Why does T7 RNA polymerase matter?

Because it connects several chemistry ideas at once: it gives you a definition you can apply, a quantity you can calculate, and a way to check whether a result is plausible.

How should I study T7 RNA polymerase?

Read the excerpt, restate it from memory, then work through the examples and applications listed on this page. The five-step study plan above takes about twenty minutes.

What does this page cover?

It gives you a compact reference excerpt plus original lgStudy explanations, examples, applications and study material on T7 RNA polymerase.